-
br Metropolitan br Urban br Rural br Insurance status br
2020-08-12
Metropolitan Urban Rural Insurance status Not insured Private/managed care Medicaid Medicare Other Miles from patient’s residence to hospital MIS Open *Surgical approach grouped by single year. Sample [11−13] and the National Surgical Quality Improvement Prog
-
br Artemisinin ART and its derivatives have long been used
2020-08-12
Artemisinin (ART) and its derivatives have long been used as anti-malarials due to their efficacy and low toxicity [6–8]. However, recent studies have shown that ART derivatives possess profound anti-tumor activity as well. These studies have shown that ART inhibits the growth of numerous types o
-
Oxidopamine br Materials and methods br Clinical samples br
2020-08-12
2. Materials and methods 2.1. Clinical samples Sixty clinical specimens including TNBC and matched tumor-ad-jacent tissues were obtained from patients, who underwent modified radical mastectomy for breast cancer. Patients who received pre-operative immunotherapy, chemotherapy or radiotherapy
-
br dramatic increase in late
2020-08-12
dramatic increase in late apoptosis phase as compared to the untreated control cells (0%). This result suggests that apoptosis occurred in a time-dependent manner in 8-PN-treated cells. 3.5. Caspase activity In this study, caspase activity of 8-PN was measured using the caspase Glo kit. Pro-
-
RGDS peptide br administration barring the use of a
2020-08-12
administration, barring the use of a delivery vehicle. Systemic circula-tion will be minimized due to the passively targeted nature of the NLB and the nano-size of the particles on account of the Enhanced Permeability and Retention (EPR) phenomenon, ultimately favorably altering the biodistributio
-
br Materials and methods br Cell cultures and
2020-08-12
Materials and methods Cell cultures and reagents Human TNBC cell lines (MDA-MB-231, BT-549, HCC70, and HCC1806) and non-tumorigenic breast cell line (MCF-10A) were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). A normal breast cell line (AG11132) was obtained f
-
br Scanning electron microscopy SEM br The morphology
2020-08-12
3.1.6. Scanning electron microscopy (SEM) The morphology and size distribution of MNPs were investigated by SEM analysis. SEM images showed a uniform pattern in both MNP-Si and MNPs, with a similar size distribution (Fig. 6). 3.2. Herceptin conjugation to MNP-Si As shown in scheme 1A, to
-
br METHOD DETAILS br Cloning br
2020-08-12
METHOD DETAILS Cloning The human kinase library plasmid kit, containing open reading frames (ORFs) in Gateway Entry vectors, was provided by William Hahn and David Root (Johannessen et al., 2010; Yang et al., 2011) via Addgene (Kit # 1000000014). The human phosphatase library was obtained fr
-
br Table describes the results for the analyses of
2020-08-12
Table 2 describes the results for the analyses of trend in newly di-agnosed cases of subtypes of Tunicamycin cancers and benign neoplasms in the temporal lobe. Newly diagnosed cases of primary malignant neoplasms in the temporal lobe have increased faster post-2005 then the coun-terfactual predic
-
br GAPDH TGACTTCAACAGCGACACCCA GAPDH CACCCTGTTGC
2020-08-12
GAPDH 1- TGACTTCAACAGCGACACCCA, GAPDH 2- CACCCTGTTGC TGTAGCCAAA; SNRPA1 1- AAAGTTCCGCAAGTCAGAGTAC, SNRPA1 2- ACCAGCACCTGGATTAAAAGT. 2.4.2. Protein isolation and Western blotting (WB) analysis Cells were lysed in a RIPA buffer (Beyotime, Cat No. P0013B). A protease cocktail inhibitor was added
-
br Fig Target NIC dUHBI analog due
2020-08-12
Fig. 4. Target NIC-dUHBI analog. due to restricted rotation, and therefore high F. In this way, enhanced fluorescence is indicative of the presence of target mRNA (Fig. 3). dU was selected as the nucleoside for conjugation with HBI-analog due to its relatively easy application to various sy
-
br Tumor stage no br chosen as the
2020-08-09
Tumor stage, no chosen as the representative sequences of corresponding OTUs. Taxo- nomic assignment of individual datasets were classified against the Greengenes database version 13.8 using both RDP classifier and HP infection, no that were identified as members of Eukarya, Archaea
-
AWD 131-138 br Single crystals of pale yellow
2020-08-07
Single crystals of 3 (pale yellow irregular fragment with approximate dimensions 0.18 0.40 0.45 mm) were mounted on a glass fiber in a random orientation. The X-ray intensity data were measured on a Bruker Smart Breeze CCD system equipped with a graphite monochromated Mo-Ka radiation (l ¼ 0.71073
-
gamma-Glu-Cys br Cell apoptosis analysis br Cell
2020-08-07
4.5. Cell-apoptosis analysis Cell apoptosis was assessed by flow cytometry (FCM) analysis. The gamma-Glu-Cys were treated with concentrations of BA (0, 5, 10, 20 μg/mL) for 48 h in a humidified incubator with 5% CO2 at 37 °C. Then, cells were harvested and washed with ice-cold phosphate-buffer
-
br adherence to national physical activity guidelines modera
2020-08-07
adherence to national physical activity guidelines (moderate level) [26,28]. Physical activity interventions should include FCGs, due to their vital role in providing physical and emotional support for older adults with cancer. Social support and goal setting were prominent themes that served a