br Artemisinin ART and its derivatives have long been used

Artemisinin (ART) and its derivatives have long been used as anti-malarials due to their efficacy and low toxicity [6–8]. However, recent studies have shown that ART derivatives possess profound anti-tumor activity as well. These studies have shown that ART inhibits the growth
of numerous types of cancer cells, including breast, lung, prostate, melanoma, renal, gastric, and CNS cancer cells [9–13]. ART can also inhibit the growth of many drug-resistant cancer cell types [9]. Ad-ditionally, ART derivatives may also inhibit the growth of human tumor xenografts transplanted into mice [13].
ART inhibits the proliferation of cancer cells through several me-chanisms: 1) ART interacts with ferrous iron [14], resulting in accu-mulation of reactive oxygen species (ROS) [15,16]. ROS then weaken the integrity of the cell [17], inducing Calpain Inhibitor I arrest [18], apoptosis [19], and autophagy [20]; 2) ART inhibits angiogenesis by inhibiting the secretion of VEGF, VEGFR2, and KDR/flk-1 in tumors [21,22]; and
3) ART may affect signaling pathways and transcription factors asso-ciated with tumor growth, including the Wnt/β-catenin pathway, the AMPK pathway, nitric oxide signaling, NF-κB, CREBP, MYC/MAX,
Corresponding author.
mTOR, and AP-1 [23]. However, the immune mechanisms affected by ART have not been described. In this study, we examined the effects of ART on anti-tumor immunity in vitro and in vivo to determine whether ART may be used to treat breast cancer.
2. Materials and methods
Mouse 4T1 mammary carcinoma cells (Cell Bank of the Chinese Academy of Sciences, Shanghai, China) were cultured in Dulbecco's modified Eagle's medium (DMEM, Gibco, Life Technologies, Inc., USA) supplemented with 10% fetal bovine serum (FBS, Hyclone, USA), 100 mg/mL streptomycin, 100 U/mL penicillin, and 1 mM L-glutamine. Cells were grown at 37 °C with 5% CO2 and 100% humidity. Experiments were performed using cells in the exponential growth phase.
Six to eight-week-old female Balb/c mice were acquired from the Center of Zoology, Chinese Academy of Sciences, Shanghai Branch. The mice were housed under standard conditions for a week prior to the beginning of the experiment and given unimpeded access to food and water. All animal experiments were conducted under the guidelines of the Guide for the Care and Use of Laboratory Animals, China law of animal welfare. The experimental protocol was approved by the Committee on the Ethics of Animal Experiments of China National Institutes of Health (permit number GB 14923-2001).
Artemisinin (ART, Sigma, St. Louis, MO, USA) was suspended in dimethylsulfoxide (DMSO, Solon, OH, USA) to create a stock solution of 10 mmol/L. The stock solution was stored at −20 °C until use and further diluted in DMEM to its final concentration for in vitro use. For the in vivo experiments, ART was diluted with sterile PBS to 5 mg/mL before administration. All flow cytometry antibodies were purchased from BD Pharmingen (San Diego, CA, USA) unless otherwise indicated. A TGF-β enzyme linked immunosorbent assay (ELISA) kit was obtained from R&D Systems (Minneapolis, MN, USA), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was purchased from Sigma (St. Louis, MO, USA), and RPMI 1640 with 10% FBS was purchased from Life Technologies (Bedford, MA, USA).
2.3. Establishment of the 4T1 breast cancer model
Sub-confluent 4T1 cells were harvested, washed once in serum-free media, and resuspended in PBS at a concentration of 5 × 105 cells/ 0.1 mL PBS. 0.1 mL of the cell suspension was then implanted into the abdominal mammary fat pad of female BALB/c mice subcutaneously. Once the tumor was palpable (5–7 days after implantation), the mice were randomized into either the control group (n = 7; intraperitoneal injection with 200 μl sterile PBS daily for 20 days) or the ART group (n = 10; intraperitoneal injection with 100 mg/kg ART dissolved in 0.2% DMSO daily for 20 days). Tumor volume was measured every 2–3 days using the following formula: V = 0.5236 × d12 × d2, where d1 is the shortest diameter and d2 is the longest diameter.
Table 1
Primer sequences for RT-PCR.
β-actin_F GATTACTGCTCTGGCTCCTAGC β-actin_R GACTCATCGTACTCCTGCTTGC IFN-γ_F GTTACTGCCACGGCACAGTCATTG IFN-γ_R ACCATCCTTTTGCCAGTTCCTCCAG TNF-α_F GCAAGCTTCGCTCTTCTGTCTACTGAACTTCGG TNF-α_R GCTCTAGAATGAGATAGCAAATCGGCTGACGG T-bet_F TCAACCAGCACCAGACAGAG T-bet_R AAACATCCTGTAATGGCTTGTG TGF-β_F TGACGTCACTGGAGTTGTACGG TGF-β_R GGTTCATGTCATGGATGGTGC Il-10_F ACCTGCTCCACTGCCTTGCT Il-10_R GGTTGCCAAGCCTTATCGGA Foxp3_F GGCCCTTCTCCAGGACAGA Foxp3_R GCTGATCATGGCTGGGTTGT
expressed as the percentage of cell growth inhibition using the fol-lowing formula: % cells = (OD of ART-treated sample / OD of untreated sample) × 100%.