Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • 2021-03
  • br GAPDH TGACTTCAACAGCGACACCCA GAPDH CACCCTGTTGC

    2020-08-12


    GAPDH 1- TGACTTCAACAGCGACACCCA, GAPDH 2- CACCCTGTTGC TGTAGCCAAA; SNRPA1 1- AAAGTTCCGCAAGTCAGAGTAC, SNRPA1 2- ACCAGCACCTGGATTAAAAGT.
    2.4.2. Protein isolation and Western blotting (WB) analysis
    Cells were lysed in a RIPA buffer (Beyotime, Cat No. P0013B). A protease cocktail inhibitor was added. Protein concentration were de-termined by BCA protein assay kit (Beyotime, Cat No. P0010S) in ac-cordance with the manufacturer’s instructions. The cell lysates were fractionated on 10% SDS-PAGE gel and blotted for 2 h at 70 mA using a semidry device. WB analysis was performed by antibody incubation in PBS containing 0.1% Tween and 5% (w/v) milk powder according to standard protocols. The following primary Necrostatin1 were used in this study: anti-SNRPA1 from rabbit (abcam, Cat. No. ab128937, 1:1000 dilution), anti-GAPDH from mouse (Santa Cruz, Cat. No. SC-32233, 1:4000 dilution), goat anti-rabbit or mouse IgG (Santa Cruz, Cat. No. SC-2004, 2005, 1:2000 dilution) were used as secondary antibodies, and ECL-Plus kit regents (Thermo, Cat No. M3121/1859022) was used for developing.
    Animal studies were approved by the animal experimentation ethics committee of Peking University Shougang Hospital, according to local and governmental regulations. 6–8 week-old specific pathogen free female BALB/c nude mice were obtained from a national rodent seed center (China laboratory Animal Center of Pharmaceutical and Biological Products Institute). All mice were housed in individually ventilated cages under a 12 h/12 h light/dark cycle with drinking water and food available ad libitum.
    the nude mice were divided into two groups (10 nude mice per group). The nude mice were intraperitoneally injected with anesthetic (a mixture of xylidinothiazoline, ethylenediaminetetraacetic acid, di-hydroetorphine hydrochloride, and haloperidol, 0.5 mg/kg).
    The RKO cells transduced with control or shSNRPA1lentivirus were collected in the exponential phase and digested into single-cell sus-pensions. Then, the concentration of RKO cells was adjusted to 1–2 × 107 cells/ml. Anesthetized nude mice were disinfected with 75% alcohol and then inoculated with 200 ul of one of the two cell sus-pensions in the middle of the right armpit. The mice were disinfected again and placed in laminar air flow rack while their physical signs were monitored. The primary implanted tumors in mice inoculated with RKO cells were collected once the diameter of the primary me-tastasis had grown to 1 cubic centimeter. To collect the tumors, the nude mice were sacrificed using cervical dislocation. The region over the tumor was disinfected, and the subcutaneously implanted tumors were removed using eye scissors and ophthalmic forceps. Tumor vo-lume and weight were then decided. The In vivo whole-body imaging of implanted tumor formed by control and shRNA lentivirus transduced RKO cells in nude mice was performed in small animal living imaging system (Perkin Elmer, Lumina LT).  Biomedicine & Pharmacotherapy 117 (2019) 109076
    2.5. Microarray gene expression profiling and data processing
    2.5.1. RNA preparation and quality control
    Total RNA from cultured RKO cells was extracted by Trizol and purified using RNeasy RNA extraction kit. Quality control of extracted RNA was subsequently examined by both Thermo Nanodrop 200 and Agilent 2100 bioanalyzer with utilization of Agilent RNA 6000 Nano Kit. Quality RNA will be subject to microarray analysis until it meets the following standards: 1.7 < A260/A280 < 2.2 by Thermo Nanodrop 200 and RIN > = 7 and 28S/18S > 0.7 by Agilent 2100 bioanalyzer.
    2.5.2. Microarray processing and data analysis
    A total of 6 GeneChip microarrays (Affymetrix 901838) were hy-bridized with 3 pairs of samples to determine gene expression profiles of the NC and KD RKO cell samples according to the manufacturer’s instructions. Briefly, qualified total RNA was firstly subject to poly(A) tailing (37 C for 15 min) and biotin ligation (25 C for 30 min) using FlashTag Biotin HSR labeling Kit before its hybridization with the mi-croarray gene chips (48 C, 60 rpm, 16–18 h) in GeneChip Hybridization Oven 645. After the hybridization, Genechip Hybridization Wash and Stain Kit was used to wash and stain the array chips on GeneChip Fluidics Station 450. Finally, microarrays were scanned by GeneChip scanner 3000 and dat and cel files were obtained using GCOS 1.1. Raw data expression was imported to R (www.r-project.org) and analyzed by the Bioconductor affy package (www.bioconductor.org). Logarithmic (base 2) intensity measures were obtained by RMA. Intensity Necrostatin1 was converted to nonlogarithmic values and rescaled by ad-justing mean intensity on each array to 400. Cel files and RMA values were deposited on Gene Expression Omnibus (www.ncibi.nih.gov/geo/ ).